Sequence ID | >WENV170963412 |
Genome ID | MRWG01000167 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 66438 |
End posion on genome | 66365 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cacccggtga |
tRNA gene sequence |
GCGGGTATAGCATAATGGTAATGCACCAGCCTTCCAAGCTGTGTATGTCGGTTCGATTCC |
Downstream region at tRNA end position |
gccgaattcc |
Secondary structure (Cloverleaf model) | >WENV170963412 Gly TCC a TCCA gccgaattcc G - C C - G G - C G - C G - C T - A A - T T T T C T G C C A A A A | | | | G T T A C G G T C G G C G | | | | T T G A T G C T A A GTAT C T C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |