Sequence ID | >WENV170963452 |
Genome ID | MRWG01000194 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 52487 |
End posion on genome | 52576 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gactaagaca |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGTTGAAGGCACCGGTCTTGAAAACCGGCAGGCGTGCAAGCGCC |
Downstream region at tRNA end position |
gttattactt |
Secondary structure (Cloverleaf model) | >WENV170963452 Ser TGA a GCCA gttattactt G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T G A A CAGGCGTGCAAGCGCCTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |