Sequence ID | >WENV170963556 |
Genome ID | MRWG01000287 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 76040 |
End posion on genome | 76124 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gagccgatac |
tRNA gene sequence |
GGAGGGATGCCCGAGTGGTTAAAGGGGACGGGCTGTAAACCCGTTGGCTATGCCTACGTT |
Downstream region at tRNA end position |
tcgctcacgc |
Secondary structure (Cloverleaf model) | >WENV170963556 Tyr GTA c ACCA tcgctcacgc G - C G - C A - T G - C G - C G - C A - T T A T C A A C C A T G A G | | | | | G G G C C C G T T G G C G | | | T T T A G G G T A A G TGGCTATGCCTAC A - T C - G G - C G - C G - C C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |