Sequence ID | >WENV170963563 |
Genome ID | MRWG01000290 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 112757 |
End posion on genome | 112843 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cgcccgccgg |
tRNA gene sequence |
GGCCCCTTGGCGAAACTGGTATACGCAGCAGACTTAAAATCTGCTTCTCGAAAGGGAGTG |
Downstream region at tRNA end position |
gccttcgctc |
Secondary structure (Cloverleaf model) | >WENV170963563 Leu TAA g ACCA gccttcgctc G - C G - C C - G C - G C - G C - G T - A T G T C G C C C A C A A G | | | | | G T A G C G G C G G G C G | | | T T G A C G C T A T A TTCTCGAAAGGGAGT G - C C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |