Sequence ID | >WENV170963675 |
Genome ID | MRWG01000485 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 24202 |
End posion on genome | 24291 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttcaggcgcc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCTGAAGGCGCGCCCCTGCTAAGGGCGTATACGTTAACGCGTA |
Downstream region at tRNA end position |
tgcaggacag |
Secondary structure (Cloverleaf model) | >WENV170963675 Ser GCT c GCCT tgcaggacag G - C G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATACGTTAACGCGTATC C - G G - C C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |