Sequence ID | >WENV170963707 |
Genome ID | MRWG01000557 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 11457 |
End posion on genome | 11383 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cctcacccgt |
tRNA gene sequence |
GCCCGGGTAGCTCAGGGGTAGAGCAGTGGATTGAAAATCCTCGTGTCGGTGGTTCGATTC |
Downstream region at tRNA end position |
tttcttcagc |
Secondary structure (Cloverleaf model) | >WENV170963707 Phe GAA t ACCA tttcttcagc G - C C - G C - G C - G G - C G - C G - C T T T C C G C C A G A A | | + | | G G C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C T T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |