Sequence ID | >WENV170963708 |
Genome ID | MRWG01000567 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 3233 |
End posion on genome | 3320 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cccccccacc |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTTTAAGGCGCACGATTGGAATTCGTGTGGGGGTTTACGCCCC |
Downstream region at tRNA end position |
cattgagacc |
Secondary structure (Cloverleaf model) | >WENV170963708 Ser GGA c GCtt cattgagacc G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A T G A G | | | | | G G G T C G G G G G G C G + | | T T T A G G C T T A G TGGGGGTTTACGCCCCTC C - G A - T C - G G - C A - T T T T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |