Sequence ID | >WENV170963726 |
Genome ID | MRWG01000598 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 12424 |
End posion on genome | 12334 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cacccacgcc |
tRNA gene sequence |
GGAGAGATGGCCGAGTGGCTGAAGGCGCCGGTTTGCTAAACCGGTGAATCGCGTCAAGCG |
Downstream region at tRNA end position |
taagaattac |
Secondary structure (Cloverleaf model) | >WENV170963726 Ser GCT c GCtt taagaattac G - C G - C A - T G - C A - T G - C A - T T A T C G C C C A T G A G | | | | | G G G C C G G C G G G C G | | | T T C A G G C T G A G TGAATCGCGTCAAGCGGTTCC C - G C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |