Sequence ID | >WENV170963869 |
Genome ID | MRWG01001075 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 5464 |
End posion on genome | 5548 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ataattttat |
tRNA gene sequence |
GGAGAGGTGCCGGAGTGGTAACGGAGCAGATTGCTAATCTGTCGACGGGTAACCGTCGCC |
Downstream region at tRNA end position |
tctcccgcta |
Secondary structure (Cloverleaf model) | >WENV170963869 Ser GCT t GCat tctcccgcta G - C G - C A - T G - C A - T G - C G + T T G T G A C C C A G A G | | | | | G T G G C C C T G G G C G | | | T T G A C G G T A A CGACGGGTAACCGTCGC G + T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |