Sequence ID | >WENV170963937 |
Genome ID | MRWG01001436 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 6211 |
End posion on genome | 6293 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaagcaattc |
tRNA gene sequence |
GGGCGGTTGCCGGAGTGGTCAAACGGGGCAGGCTGTAAACCTGCTGGCTTACGCCTTCGG |
Downstream region at tRNA end position |
gaattgaatg |
Secondary structure (Cloverleaf model) | >WENV170963937 Tyr GTA c Attt gaattgaatg G - C G - C G - C C - G G - C G - C T - A T A T C T C C C A T G A G | + | | | G G G G C C G G G G G C G | | | T T T A C G G C A A G TGGCTTACGCCTTC G - C C - G A - T G - C G - C C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |