Sequence ID | >WENV170963954 |
Genome ID | MRWG01001593 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 5937 |
End posion on genome | 5854 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
caggtcggac |
tRNA gene sequence |
GCGGGTGTGGCGGAATGGTAGACGCGAGGGTCTCAAACACCCTTTCCGCAAGGAGTGTCG |
Downstream region at tRNA end position |
tttctacccc |
Secondary structure (Cloverleaf model) | >WENV170963954 Leu CAA c ACCA tttctacccc G - C C - G G - C G - C G - C T - A G - C T G T C A G C C A T A A G | | | | | G G G G C G G T C G G C G | | | T T T A C G C A G G TTCCGCAAGGAGT A - T G - C G - C G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |