Sequence ID | >WENV170963971 |
Genome ID | MRWG01001674 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 11394 |
End posion on genome | 11308 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
caccaccggc |
tRNA gene sequence |
GCGGGCGTGGCGGAATTGGTAGACGCAGCAGACTTAAAATCTGCCGGCCGCAAGGCCGTG |
Downstream region at tRNA end position |
gctttttcga |
Secondary structure (Cloverleaf model) | >WENV170963971 Leu TAA c ACCA gctttttcga G - C C - G G - C G - C G - C C - G G - C C T T C G G C C A T A A G | | | | | A T G G C G G C C G G C G | | | T T G A C G C T A G A CGGCCGCAAGGCCGT G - C C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |