Sequence ID | >WENV170963972 |
Genome ID | MRWG01001681 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 2772 |
End posion on genome | 2683 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
agcatctcgc |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTTGAAAGCACCGCACTCGAAATGCGGCATACTCGCAAGGGTA |
Downstream region at tRNA end position |
tacatcgctg |
Secondary structure (Cloverleaf model) | >WENV170963972 Ser CGA c GCCA tacatcgctg G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | + | | | G G G T C G G G G G G C G | | | T T T A A G C T G A A CATACTCGCAAGGGTATC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |