Sequence ID | >WENV170963994 |
Genome ID | MRWG01001801 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1368 |
End posion on genome | 1279 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tgcgatcagc |
tRNA gene sequence |
GGAGAGGTGGCCGAGAGGCTGAAGGCGCACGCTTGGAAAGCGTGTAGGCGGGAAACCGTC |
Downstream region at tRNA end position |
cgcagtcagc |
Secondary structure (Cloverleaf model) | >WENV170963994 Ser GGA c GCCA cgcagtcagc G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A A G A G | | | | | G G G C C G G T G G G C G | | | T T C A G G C T G A G TAGGCGGGAAACCGTCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |