Sequence ID | >WENV170964029 |
Genome ID | MRWG01002171 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 9422 |
End posion on genome | 9331 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ccgcgcccgc |
tRNA gene sequence |
GGAGGGATGCCAGAGCGGTTGAATGGGGCGGTCTCGAAAACCGTTAAGGGCGGTGACGTC |
Downstream region at tRNA end position |
gcgacccgcc |
Secondary structure (Cloverleaf model) | >WENV170964029 Ser CGA c GCCA gcgacccgcc G - C G - C A - T G - C G - C G - C A - T T A T C T C C C A C G A G | | | | | G G G A C C G A G G G C G | | | T T T A T G G T G A G TAAGGGCGGTGACGTCCTTC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |