Sequence ID | >WENV170964154 |
Genome ID | MRWG01003976 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 3755 |
End posion on genome | 3841 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
acgccccagt |
tRNA gene sequence |
GCGGTCGTGGCGGAACTGGTAGACGCGCAGCGTTGAGGTCGCTGTCCCAGCAATGGGGTG |
Downstream region at tRNA end position |
aatctctcaa |
Secondary structure (Cloverleaf model) | >WENV170964154 Leu GAG t ACCA aatctctcaa G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A C A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TCCCAGCAATGGGGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |