Sequence ID | >WENV170964246 |
Genome ID | MRWG01005874 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 2795 |
End posion on genome | 2710 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gaagtcattg |
tRNA gene sequence |
GCCCGAGTGGCGGAACTGGTATACGCGATGGATTCAAAATCCATTGTCCTTTGGGCGTGC |
Downstream region at tRNA end position |
ctcgtcgctg |
Secondary structure (Cloverleaf model) | >WENV170964246 Leu CAA g ACCA ctcgtcgctg G - C C - G C - G C - G G - C A - T G - C T C T C G C C C A C A A G | | | | | G T G G C G G C G G G C G | | | T T G A C G C T A T G TGTCCTTTGGGCGT A - T T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |