Sequence ID | >WENV170964260 |
Genome ID | MRWG01006211 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 2663 |
End posion on genome | 2572 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atgcgcaata |
tRNA gene sequence |
GGACAGGTGGGTGAGTGGCTTAAACCAGTGGATTGCTAATCCGCCGTACCTGTAACCGGG |
Downstream region at tRNA end position |
tctttggccg |
Secondary structure (Cloverleaf model) | >WENV170964260 Ser GCT a GCCA tctttggccg G - C G - C A - T C - G A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T T A A CGTACCTGTAACCGGGTACC G - C T + G G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |