Sequence ID | >WENV170964261 |
Genome ID | MRWG01006248 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 3855 |
End posion on genome | 3769 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acctccaccc |
tRNA gene sequence |
GCCCGGGTGGCGAAACTGGTAGACGCGCCAGACTCAAAATCTGGTTCCCGCGAGGGAGTG |
Downstream region at tRNA end position |
gccgatgctt |
Secondary structure (Cloverleaf model) | >WENV170964261 Leu CAA c ACCA gccgatgctt G - C C - G C - G C - G G - C G - C G - C T C T C A G C C A C A A G | | | | | G T A G C G G T C G G C G | | | T T G A C G C T A G G TTCCCGCGAGGGAGT C - G C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |