Sequence ID | >WENV170964264 |
Genome ID | MRWG01006285 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 472 |
End posion on genome | 388 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acgacccttt |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGTTAAAGGCAGCAGACTGTAAATCTGCCCGCATAGCGTACACA |
Downstream region at tRNA end position |
ttcattctgg |
Secondary structure (Cloverleaf model) | >WENV170964264 Tyr GTA t ACCA ttcattctgg G - C G - C A - T G - C G - C G - C G - C T A T T G T C C A T G A G | | | | | G G G C C G A C A G G C G | | | T T T A G G C T A A A CCGCATAGCGTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |