Sequence ID | >WENV170964296 |
Genome ID | MRWG01007225 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1368 |
End posion on genome | 1454 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gccgcccgat |
tRNA gene sequence |
GCCCCTGTGGCGGAACCGGTAGACGCGGCAGACTCAAAATCTGTTTCCCGCAAGGGAGTG |
Downstream region at tRNA end position |
ttcttcggac |
Secondary structure (Cloverleaf model) | >WENV170964296 Leu CAA t ACCA ttcttcggac G - C C - G C - G C - G C - G T + G G - C T G T C C C T C A C A A G | | | | | G C G G C G G G G A G C G | | | T T G A C G C T A G G TTCCCGCAAGGGAGT G + T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |