Sequence ID | >WENV170964406 |
Genome ID | MRWG01010253 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 2000 |
End posion on genome | 1913 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gcgacaatcc |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGCTGAAGGAGCAGCACTGGAAATGCTGTATACGGGCAACCGTA |
Downstream region at tRNA end position |
tcctgattcc |
Secondary structure (Cloverleaf model) | >WENV170964406 Ser GGA c GCtt tcctgattcc G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A T G A G | | | | | G G G C C T G G G G G C G | | | T T C A G G A T G A G TATACGGGCAACCGTATC C - G A - T G - C C - G A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |