Sequence ID | >WENV170964426 |
Genome ID | MRWG01010980 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 2169 |
End posion on genome | 2253 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctataaaaaa |
tRNA gene sequence |
GCCGAAGTGGCGGAACTTGGTAGACGCGCTGGATTCAGGATCCAGTGGGTGAAAGCTCGT |
Downstream region at tRNA end position |
catagcggaa |
Secondary structure (Cloverleaf model) | >WENV170964426 Leu CAG a Agag catagcggaa G - C C - G C - G G - C A - T A - T G - C T A T C C C C C A T C A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGGGTGAAAGCTCGT C - G T - A G - C G - C A - T T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |