Sequence ID | >WENV170964448 |
Genome ID | MRWG01012494 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1702 |
End posion on genome | 1789 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccgcgcctcc |
tRNA gene sequence |
GGAGGGGTGGCTGAGCGGTCGAAAGCACCGGTCTTGAAAACCGGCGACCTTCACGGGTCC |
Downstream region at tRNA end position |
tataacgcca |
Secondary structure (Cloverleaf model) | >WENV170964448 Ser TGA c GCCA tataacgcca G - C G - C A - T G - C G - C G - C G - C T A T G T C C C A C G A G | | | | | G G G T C G C A G G G C G | | | T T T A A G C C G A A CGACCTTCACGGGTCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |