Sequence ID | >WENV170964488 |
Genome ID | MRWG01014399 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 1505 |
End posion on genome | 1590 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaagacggac |
tRNA gene sequence |
GGTGGGGTGGCCGAGTGGTTAAAGGCAGCAGACTGTAAATCTGCCCGCGTATGCGTACGT |
Downstream region at tRNA end position |
acttccgatg |
Secondary structure (Cloverleaf model) | >WENV170964488 Tyr GTA c ACCA acttccgatg G - C G - C T - A G - C G - C G - C G - C T A T C A T C C A T G A G | | | | | G G G C C G G T A G G C G | | | T T T A G G C T A A A CCGCGTATGCGTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |