Sequence ID | >WENV170964572 |
Genome ID | MRWG01019865 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 295 |
End posion on genome | 209 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
agcgacagat |
tRNA gene sequence |
TCCCCTCTGGCGGAACTGGTAGACGCGCTGGATTCAAAATCCAGTTCCTTTGCGGGAGTG |
Downstream region at tRNA end position |
tgagctgaaa |
Secondary structure (Cloverleaf model) | >WENV170964572 Leu CAA t ACCA tgagctgaaa T C C - G C - G C - G C - G T + G C - G T T T C G G C C A C A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T A G G TTCCTTTGCGGGAGT C - G T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |