Sequence ID | >WENV170964594 |
Genome ID | MRWG01021992 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 736 |
End posion on genome | 820 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cttgaatttt |
tRNA gene sequence |
GGAGGGGTACCCAAGCGGTCAACGGGGGCAGACTGTAAATCTGTTGGCTCAGCCTTCGTA |
Downstream region at tRNA end position |
gtttcagctt |
Secondary structure (Cloverleaf model) | >WENV170964594 Tyr GTA t ACCA gtttcagctt G - C G - C A - T G - C G - C G - C G - C A G T A A T C C A C G A A | | | | G G A C C C G T A G G C G | | | T T T C G G G C A A G TGGCTCAGCCTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |