Sequence ID | >WENV170964658 |
Genome ID | MRWG01027796 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 53 |
End posion on genome | 144 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ctcgctttgc |
tRNA gene sequence |
GGAGGGGTGGCCGAGAGGCTGAAGGCGGCGGTTTGCTAAACCGTTATACGGGGAAACTCG |
Downstream region at tRNA end position |
ctcacccccg |
Secondary structure (Cloverleaf model) | >WENV170964658 Ser GCT c GCCA ctcacccccg G - C G - C A - T G - C G - C G - C G - C T A T T A C C C A A G A G + | | | | G G G C C G G T G G G C G | | | T T C A G G C T G A G TATACGGGGAAACTCGTATC G + T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |