Sequence ID | >WENV170964717 |
Genome ID | MRWG01034017 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 23 |
End posion on genome | 113 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ccggctctgt |
tRNA gene sequence |
GGATGGGTGGCCGAGCGGTCGAAGGCGCACGCTTGGAAAGCGTGTTTACGGTAACCCCGT |
Downstream region at tRNA end position |
tcctgcttcg |
Secondary structure (Cloverleaf model) | >WENV170964717 Ser GGA t GCCA tcctgcttcg G - C G - C A - T T - A G - C G - C G - C T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C C G A G TTTACGGTAACCCCGTAAC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |