Sequence ID | >WENV170964738 |
Genome ID | MRWG01036584 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 105 |
End posion on genome | 191 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcgtttccgg |
tRNA gene sequence |
GCCCCTGTGGCGGAATTGGTAGACGCGACAGACTCAAAATCTGTTTCCCGCAAGGGAGTG |
Downstream region at tRNA end position |
agctctcact |
Secondary structure (Cloverleaf model) | >WENV170964738 Leu CAA g ACCA agctctcact G - C C - G C - G C - G C - G T - A G - C T G T C G G A C A T A A G | | | | | G T G G C G G C C T G C G | | | T T G A C G C T A G G TTCCCGCAAGGGAGT A - T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |