Sequence ID | >WENV170964749 |
Genome ID | MRWG01038136 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 113 |
End posion on genome | 202 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tccgttccct |
tRNA gene sequence |
GGAGAGGTGCCGGAGTGGTCGAACGGGGCGGTCTCGAAAACCGTTGTGCGGGTAACCGCA |
Downstream region at tRNA end position |
gccaataaat |
Secondary structure (Cloverleaf model) | >WENV170964749 Ser CGA t GCCA gccaataaat G - C G - C A - T G - C A - T G - C G + T T A T C T C T C A T G A G | | | + | G G G G C C G A G G G C G | | | T T T A C G G C G A G TGTGCGGGTAACCGCACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |