Sequence ID | >WENV170964753 |
Genome ID | MRWG01039448 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 349 |
End posion on genome | 266 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gtgcgcagcc |
tRNA gene sequence |
GCGGGCGTGGCGGAACTGGCAGACGCGCGGGGTTTAGGTCCCCGTGTCCGCAAGGACGTG |
Downstream region at tRNA end position |
gatccgccga |
Secondary structure (Cloverleaf model) | >WENV170964753 Leu TAG c Attc gatccgccga G - C C - G G - C G - C G - C C - G G - C T C T T G T C C A C A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C C A G G TGTCCGCAAGGACGT C - G G - C G - C G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |