Sequence ID | >WENV170964790 |
Genome ID | MRWG01044082 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 482 |
End posion on genome | 566 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gataaccgtc |
tRNA gene sequence |
GGCCCCGTGGCGGAACTGGTAGACGCACGCGACTTAAAATCGCGAGCCTTCGGGCGTGCG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170964790 Leu TAA c ACCA nnnnnnnnnn G - C G - C C - G C - G C - G C - G G - C T G T C G C C C A C A A G | | | | | G T G G C G G C G G G C G | | | T T G A C G C T A G A AGCCTTCGGGCGT C - G G - C C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |