Sequence ID | >WENV170964951 |
Genome ID | MRWG01085663 |
Phylum/Class | [MRWG] biofilm metagenome; microbial consortium enriched at the cathode of a solar microbial fuel cell |
Species | |
Start position on genome | 279 |
End posion on genome | 195 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCCCAGGTGTTGGAACTGGTAGACAAGCTGGATTTAGGTTCCAGTGCCGCAAGGCGTGCG |
Downstream region at tRNA end position |
tcgtcgcggc |
Secondary structure (Cloverleaf model) | >WENV170964951 Leu TAG n ACCA tcgtcgcggc G - C C - G C - G C - G A - T G - C G - C T G T C G C C C A C A A G | | | | | G T G G T T G C G G G C G | | | T T G A C A A T A G G TGCCGCAAGGCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |