Sequence ID | >WENV170965692 |
Genome ID | MTEV01000314 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 267 |
End posion on genome | 359 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agaaaacccc |
tRNA gene sequence |
GGAGTGATGCCCGAGTGGCCGAAGGGGCTCCCCTGCTAAGGGAGTATAGGGTCAAAAGCT |
Downstream region at tRNA end position |
gatataaaga |
Secondary structure (Cloverleaf model) | >WENV170965692 Ser GCT c GCCA gatataaaga G - C G - C A - T G - C T - A G - C A - T T A T C T C C C A T G A G | | | | | G G G C C C G A G G G C G | | | T T C A G G G C G A G TATAGGGTCAAAAGCTCTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |