Sequence ID | >WENV170965734 |
Genome ID | MTEV01001406 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 2577 |
End posion on genome | 2663 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agtattccgt |
tRNA gene sequence |
ACCGAGGTGGTGGAATTGGTAGACACGCTACCTTGAGGTGGTAGTGCCCTAACGGGCTTG |
Downstream region at tRNA end position |
atattccaga |
Secondary structure (Cloverleaf model) | >WENV170965734 Leu GAG t ACCA atattccaga A - T C - G C - G G - C A - T G - C G - C T G T T A C C C A T A A G + | | | | G T G G T G G T G G G C G | | | T T G A C A C T A G G TGCCCTAACGGGCTT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |