Sequence ID | >WENV170965782 |
Genome ID | MTEV01003563 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 57240 |
End posion on genome | 57326 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaaccgtgcc |
tRNA gene sequence |
GCCCGGATGGCGAAATTGGTAGACGCAAGAGACTTAAAATCTCTCGGTGGCAACACCGTG |
Downstream region at tRNA end position |
ggctcttcgc |
Secondary structure (Cloverleaf model) | >WENV170965782 Leu TAA c ACCA ggctcttcgc G - C C - G C - G C - G G - C G - C A - T C G T C G G C C A T A A G | | | | | G T A G C G G C C G G C G | | | T T G A C G C T A G A CGGTGGCAACACCGT A - T G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |