Sequence ID | >WENV170965787 |
Genome ID | MTEV01003620 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 4748 |
End posion on genome | 4664 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcgcgcaccc |
tRNA gene sequence |
GCCCGGGTGGTGAAACAGGTAGACGCAGGGGACTCAAAATCCCCCGCCGCAAGGCGTGTC |
Downstream region at tRNA end position |
aatcccaaga |
Secondary structure (Cloverleaf model) | >WENV170965787 Leu CAA c ACCA aatcccaaga G - C C - G C - G C - G G - C G - C G - C T G T C A G C C A C A A G | | | | | G A A G T G G T C G G C G | + | T T G A C G C T A G A CGCCGCAAGGCGT G - C G - C G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |