Sequence ID | >WENV170965797 |
Genome ID | MTEV01003932 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 1655 |
End posion on genome | 1739 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccccttcagt |
tRNA gene sequence |
GCCGAAGTGGCGAAATCGGTAGACGCAGTTGATTCAAAATCAACCGTAGAAATACGTGCC |
Downstream region at tRNA end position |
agtcactaaa |
Secondary structure (Cloverleaf model) | >WENV170965797 Leu CAA t ACCA agtcactaaa G - C C - G C - G G - C A - T A - T G - C T G T C G G C C A T A A G | | | | | G C A G C G G C C G G C G | | | T T G A C G C T A G A CGTAGAAATACGT G - C T - A T - A G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |