Sequence ID | >WENV170965800 |
Genome ID | MTEV01004056 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 22499 |
End posion on genome | 22585 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agtcaagcaa |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGACCTTACGGTCGTG |
Downstream region at tRNA end position |
tctgaaacgc |
Secondary structure (Cloverleaf model) | >WENV170965800 Leu GAG a ACCA tctgaaacgc G - C C - G C - G G - C A - T A - T G - C T G T C G C C C A T A A G | | | | | A T G G T G G C G G G C G | | | T T G A C A C T A G G TGACCTTACGGTCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |