Sequence ID | >WENV170965807 |
Genome ID | MTEV01004625 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 372 |
End posion on genome | 282 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgcccttacc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTAGACCTCATAAGGGT |
Downstream region at tRNA end position |
gttgctccac |
Secondary structure (Cloverleaf model) | >WENV170965807 Ser GCT c GCCA gttgctccac G - C G - C A - T G - C A - T G - C G - C T A T T A C C C A T G A G + | | | | G G G C C G G T G G G C G | | | T T T A G G C C G A G TAGACCTCATAAGGGTCTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |