Sequence ID | >WENV170965815 |
Genome ID | MTEV01004993 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 184042 |
End posion on genome | 183957 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ggcaattgct |
tRNA gene sequence |
GCGGTCGTGGCGAAATTGGTATACGCAACGGACTTAAAATCCGTCGTCTTTTAGACTTGC |
Downstream region at tRNA end position |
cctccgctca |
Secondary structure (Cloverleaf model) | >WENV170965815 Leu TAA t ACCA cctccgctca G - C C - G G - C G - C T - A C - G G - C T G T C G C C C A T A A G | | | | | A T A G C G G C G G G C G | | | T T G A C G C T A T A CGTCTTTTAGACTT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |