Sequence ID | >WENV170965816 |
Genome ID | MTEV01004993 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 108095 |
End posion on genome | 108022 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
attacagttt |
tRNA gene sequence |
GCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCTGAACGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gccggcccca |
Secondary structure (Cloverleaf model) | >WENV170965816 Gly CCC t TCCA gccggcccca G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A A A G | | | | | G T T G T A G C G G G C G + | | T T G G C C T T A G ACGC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |