Sequence ID | >WENV170965818 |
Genome ID | MTEV01005410 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 4771 |
End posion on genome | 4857 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgcctggacc |
tRNA gene sequence |
GCGAGGGTGGCGAAATTGGTAGACGCACCAGGTTTAGGTCCTGACGCCAGCAATGGTGTA |
Downstream region at tRNA end position |
caccgcttca |
Secondary structure (Cloverleaf model) | >WENV170965818 Leu TAG c ACCA caccgcttca G - C C - G G - C A - T G - C G - C G - C T G T T C C C C A T A A G | | | | | G T A G C G A G G G G C G | | | T T G A C G C T A G A CGCCAGCAATGGTGT C A C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |