Sequence ID | >WENV170965829 |
Genome ID | MTEV01005852 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 2204 |
End posion on genome | 2120 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agccggccac |
tRNA gene sequence |
GCGAAAGTGGCGGAATTGGTAGACGCCCTGGATTTAGGTTCCAGTGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
gtgccggcct |
Secondary structure (Cloverleaf model) | >WENV170965829 Leu TAG c ACCA gtgccggcct G - C C - G G - C A - T A - T A - T G - C T G T C C C C C A T A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C T A G C TGCCGCAAGGCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |