Sequence ID | >WENV170965855 |
Genome ID | MTEV01007273 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 4431 |
End posion on genome | 4342 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgcacaacgc |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTTGAAAGCACCGCACTCGAAATGCGGCATGGGGGCAACTCCA |
Downstream region at tRNA end position |
tttatttcct |
Secondary structure (Cloverleaf model) | >WENV170965855 Ser CGA c GCCA tttatttcct G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | + | | | G G G T C G G G G G G C G | | | T T T A A G C T G A A CATGGGGGCAACTCCATC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |