Sequence ID | >WENV170965864 |
Genome ID | MTEV01007696 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 159153 |
End posion on genome | 159071 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cggttcagaa |
tRNA gene sequence |
GCGGATGTGGCGAAATTGGTAGACGCACCAGATTTAGGTTCTGGCGGGAGACCGTGGGGG |
Downstream region at tRNA end position |
actgccataa |
Secondary structure (Cloverleaf model) | >WENV170965864 Leu TAG a ACCA actgccataa G - C C - G G - C G - C A - T T - A G - C T G T C T C C C A T A A G | + | | | G T A G C G G G G G G C G | | | T T G A C G C T A G A CGGGAGACCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |