Sequence ID | >WENV170965892 |
Genome ID | MTEV01008431 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 18790 |
End posion on genome | 18863 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tttgatttaa |
tRNA gene sequence |
GGCTGAGTTGCAGAGTGGTTATGCACCGGATTGCAAATCCGTGAACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170965892 Cys GCA a TCCA annnnnnnnn G - C G - C C - G T - A G - C A - T G - C T T T C A G C C A G A T | | | | G T G A C G G C C G G C G | | | T T G A T G C T T A GAAC C T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |