Sequence ID | >WENV170965922 |
Genome ID | MTEV01009910 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 842 |
End posion on genome | 931 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cgcgccgctt |
tRNA gene sequence |
GGGAAGATGCCGGAGTGGTCGAACGGGACGGATTCGAAATCCGTTGTGTCAGCAATGGCA |
Downstream region at tRNA end position |
tataaaaaac |
Secondary structure (Cloverleaf model) | >WENV170965922 Ser CGA t GCCA tataaaaaac G - C G - C G - C A - T A - T G - C A - T T A T A T C C C A T G A G | | | | | A G G G C C T A G G G C G | | | T T T A C G G C G A G TGTGTCAGCAATGGCACC A - T C - G G - C G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |