Sequence ID | >WENV170965928 |
Genome ID | MTEV01010212 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 1463 |
End posion on genome | 1552 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tcatgggact |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTTTAAGGCAGCAGTCTTGAAAACTGCCGATGGGGTGACCCAT |
Downstream region at tRNA end position |
ctgcaaacgc |
Secondary structure (Cloverleaf model) | >WENV170965928 Ser TGA t GCCA ctgcaaacgc G - C G - C A - T G - C A - T C - G G - C T A T C A C T C A T G A G | | | | | G G G C C G G T G A G C G | | | T T T A G G C T T A A CGATGGGGTGACCCATCC G - C C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |